MediaWiki extensions manual - list

Release status: stable

Implementation Tag
Description Displays a DNA Sequence
Author(s) Pierre Lindenbaum
Last version 1.0 (2009-01-04)
MediaWiki Tested on 1.13.3
License No license specified
Download see below
Check usage and version matrix

This Mediawiki extension enables you to display a DNA Sequence.

Screenshot Edit

File:DNASeq Extention Tag.jpeg


<dnaseq>ATGACTGACAC ACTGATAGCTACGATCtagctagca N Y N N N tgctacgatgctagcatgctagctgac</dnaseq>


The source is available here:

another version , proposed by Niklas Laxström



require_once("$IP/extensions/dnaseq/dnaseq.php"); your LocalSettings.php file.

and copy the source to $IP/extensions/dnaseq/dnaseq.php


To DoEdit

CSS, base indexing, sending to blast...