FANDOM


MediaWiki extensions manual - list
DNASeq

Release status: stable

Implementation Tag
Description Displays a DNA Sequence
Author(s) Pierre Lindenbaum
Last version 1.0 (2009-01-04)
MediaWiki Tested on 1.13.3
License No license specified
Download see below
Check usage and version matrix

This Mediawiki extension enables you to display a DNA Sequence.

Screenshot Edit

File:DNASeq Extention Tag.jpeg

UsageEdit

<dnaseq>ATGACTGACAC ACTGATAGCTACGATCtagctagca N Y N N N tgctacgatgctagcatgctagctgac</dnaseq>

SourceEdit

The source is available here: http://code.google.com/p/lindenb/source/browse/trunk/proj/mediawiki/extensions/dnaseq/dnaseq.php

another version , proposed by Niklas Laxström

InstallationEdit

Add...

require_once("$IP/extensions/dnaseq/dnaseq.php");

...to your LocalSettings.php file.

and copy the source to $IP/extensions/dnaseq/dnaseq.php

ReferenceEdit

To DoEdit

CSS, base indexing, sending to blast...

Ad blocker interference detected!


Wikia is a free-to-use site that makes money from advertising. We have a modified experience for viewers using ad blockers

Wikia is not accessible if you’ve made further modifications. Remove the custom ad blocker rule(s) and the page will load as expected.